Oligo Database

Deprecated: preg_split(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/wp-includes/formatting.php on line 3069

ID	Oligo Sequence	Len	TM	Tags	Template	Owner
pGG-186	ACTCTAATGGCGAGAATGTTTTGT View/Edit \| Copy Sequence	24	52	stress gene rtPCR qPCR	Corazonin	Oriane Armand
pGG-187	ATTGAACGGATAGTGGCTAATGTT View/Edit \| Copy Sequence	24	52	stress gene rtPCR qPCR	Corazonin	Oriane Armand
pGG-188	TTGACAACCGGCTAGTCACT View/Edit \| Copy Sequence	20	51	stress gene rtPCR qPCR	HSP70	Oriane Armand
pGG-189	GGTGTAGAAGTCTTGGCCCT View/Edit \| Copy Sequence	20	53	stress gene rtPCR qPCR	HSP70	Oriane Armand
pGG-190	CATCATGGACAACTGCGAGG View/Edit \| Copy Sequence	20	53	stress gene rtPCR qPCR	HSP83	Oriane Armand
pGG-191	AGTTCTCCTTGTCCTCGGTG View/Edit \| Copy Sequence	20	53	stress gene rtPCR qPCR	HSP83	Oriane Armand
pGG-192	GTCCCTCTACGATGCCATCA View/Edit \| Copy Sequence	20	53	stress gene rtPCR qPCR	SNF4a	Oriane Armand
pGG-193	GTACGCGGGCTTTGGTAATT View/Edit \| Copy Sequence	20	51	stress gene rtPCR qPCR	SNF4a	Oriane Armand
pGG-194	AGCCACATGAAGGAGAGCTT View/Edit \| Copy Sequence	20	51	stress gene rtPCR qPCR	Hif1	Oriane Armand
pGG-195	CTTCCCAGAACTGTTGGTGC View/Edit \| Copy Sequence	20	53	stress gene rtPCR qPCR	Hif1	Oriane Armand
pGG-196	CGCCCTTCCTCAAGCAATAC View/Edit \| Copy Sequence	20	53	stress gene rtPCR qPCR	p38a	Oriane Armand
pGG-197	CCACGAACAACTGCCTTTGA View/Edit \| Copy Sequence	20	51	stress gene rtPCR qPCR	p38a	Oriane Armand
pGG-198	ATCCCAGTTTGACCCCTGAG View/Edit \| Copy Sequence	20	53	stress gene rtPCR qPCR	Tot	Oriane Armand
pGG-199	AAGAATCCAGTTGCAAGGCC View/Edit \| Copy Sequence	20	51	stress gene rtPCR qPCR	Tot	Oriane Armand
pGG-200	TTCTGGGCAATGAGACGCTA View/Edit \| Copy Sequence	20	51	stress gene rtPCR qPCR	JH	Oriane Armand
pGG-201	CATGCTGGCCCTGGAAATAC View/Edit \| Copy Sequence	20	53	stress gene rtPCR qPCR	JH	Oriane Armand
pGG-202	GAGCACGTCACCAGCAATAG View/Edit \| Copy Sequence	20	53	stress gene rtPCR qPCR	Dop2R	Oriane Armand
pGG-203	AACGAAACGAAACTGGAGCC View/Edit \| Copy Sequence	20	51	stress gene rtPCR qPCR	Dop2R	Oriane Armand
pGG-204	CGAACAAAAGACCGCGACTT View/Edit \| Copy Sequence	20	51	stress gene rtPCR qPCR	EcRA	Oriane Armand
pGG-205	GCCTGGACTAGGAGTGGACAT View/Edit \| Copy Sequence	21	56	stress gene rtPCR qPCR	EcRA	Oriane Armand
pGG-206	AAGGATCAGTTGAAGCCCGA View/Edit \| Copy Sequence	20	51	stress gene rtPCR qPCR	GstD5	Oriane Armand
pGG-207	CTTGGGGAAGAGGGTGTCAT View/Edit \| Copy Sequence	20	53	stress gene rtPCR qPCR	GstD5	Oriane Armand
pGG-208	CAACTCTGAATTTGGCTCTCATCC View/Edit \| Copy Sequence	24	55	stress gene rtPCR qPCR	Cyp4e3	Oriane Armand
pGG-209	AGCGGGTTTCTCCTCCTCAA View/Edit \| Copy Sequence	20	53	stress gene rtPCR qPCR	Cyp4e3	Oriane Armand
pGG-210	CCGCTTCAAGGGACAGTATCTG View/Edit \| Copy Sequence	22	56	stress gene rtPCR qPCR	RP49	Oriane Armand
pGG-211	CACGTTGTGCACCAGGAACTT View/Edit \| Copy Sequence	21	54	stress gene rtPCR qPCR	RP49	Oriane Armand

Scroll to bottom

Add

Edit

Order